Berberine Depresses Inflammation and Adjusts Smooth Muscle to Ameliorate Ulcerative Colitis of Cats by Regulating Gut Microbiota.
Study Design
- 연구 유형
- Other
- 대상 집단
- DSS-induced UC cat model
- 중재
- Berberine Depresses Inflammation and Adjusts Smooth Muscle to Ameliorate Ulcerative Colitis of Cats by Regulating Gut Microbiota. None
- 대조군
- None
- 일차 결과
- Colitis, inflammation, gut microbiota, smooth muscle
- 효과 방향
- Positive
- 비뚤림 위험
- Unclear
Abstract
Intestinal microbiota dysbiosis is a well established characteristic of ulcerative colitis (UC). Regulating the gut microbiota is an effective UC treatment strategy. Berberine (BBR), an alkaloid extracted from several Chinese herbs, is a common traditional Chinese medicine. To establish the efficacy and mechanism of action of BBR, we constructed a UC model using healthy adult shorthair cats to conduct a systematic study of colonic tissue pathology, inflammatory factor expression, and gut microbiota structure. We investigated the therapeutic capacity of BBR for regulating the gut microbiota and thus work against UC in cats using 16S rRNA genes amplicon sequencing technology. Our results revealed that dextran sulfate sodium (DSS)-induced cat models of UC showed weight loss, diarrhea accompanied by mucous and blood, histological abnormalities, and shortening of the colon, all of which were significantly alleviated by supplementation with BBR. A 16S rRNA gene-based microbiota analysis demonstrated that BBR could significantly benefit gut microbiota. Western blot, quantitative PCR, and enzyme-linked immunosorbent assays (ELISAs) showed that in DSS-induced cat models, the expression of the inflammatory factors was increased, activating the JAK2/STAT3 signaling pathway, and treatment with BBR reversed this effect. The myosin light chain (MLC) phosphorylation in the smooth muscle of the intestines is associated with motility of inflammation-related diarrhea in cats. This study used gut flora analyses to demonstrate the anti-UC effects of BBR and its potential therapeutic mechanisms and offers novel insights into the prevention of inflammatory diseases using natural products. IMPORTANCE Ulcerative colitis (UC) is common in clinics. Intestinal microbiota disorder is correlated with ulcerative colitis. Although there are many studies on ulcerative colitis in rats, there are few studies on colitis in cats. Therefore, this study explored the possibility of the use of BBR as a safe and efficient treatment for colitis in cats. The results demonstrated the therapeutic effects of BBR on UC based on the state of the intestinal flora. The study found BBR supplementation to be effective against dextran sulfate sodium (DSS)-induced colitis, smooth muscle damage, and gut microbiota dysbiosis.
요약
Gut flora analyses were used to demonstrate the anti-UC effects of BBR and its potential therapeutic mechanisms and offers novel insights into the prevention of inflammatory diseases using natural products.
Full Text
RESEARCH ARTICLE
Berberine Depresses Inflammation and Adjusts Smooth Muscle to Ameliorate Ulcerative Colitis of Cats by Regulating Gut Microbiota
Xueying Li,a Shuang Xu,a Yanhe Zhang,a Kan Li,a Xue-Jiao Gao,a Meng-yao Guoa
aDepartment of Clinical Veterinary Medicine, College of Veterinary Medicine, Northeast Agricultural University, Harbin, People’s Republic of China
ABSTRACT Intestinal microbiota dysbiosis is a well established characteristic of ulcerative colitis (UC). Regulating the gut microbiota is an effective UC treatment strategy. Berberine (BBR), an alkaloid extracted from several Chinese herbs, is a common traditional Chinese medicine. To establish the efficacy and mechanism of action of BBR, we constructed a UC model using healthy adult shorthair cats to conduct a systematic study of colonic tissue pathology, inflammatory factor expression, and gut microbiota structure. We investigated the therapeutic capacity of BBR for regulating the gut microbiota and thus work against UC in cats using 16S rRNA genes amplicon sequencing technology. Our results revealed that dextran sulfate sodium (DSS)-induced cat models of UC showed weight loss, diarrhea accompanied by mucous and blood, histological abnormalities, and shortening of the colon, all of which were significantly alleviated by supplementation with BBR. A 16S rRNA gene-based microbiota analysis demonstrated that BBR could significantly benefit gut microbiota. Western blot, quantitative PCR, and enzyme-linked immunosorbent assays (ELISAs) showed that in DSS-induced cat models, the expression of the inflammatory factors was increased, activating the JAK2/STAT3 signaling pathway, and treatment with BBR reversed this effect. The myosin light chain (MLC) phosphorylation in the smooth muscle of the intestines is associated with motility of inflammation-related diarrhea in cats. This study used gut flora analyses to demonstrate the anti-UC effects of BBR and its potential therapeutic mechanisms and offers novel insights into the prevention of inflammatory diseases using natural products.
IMPORTANCE Ulcerative colitis (UC) is common in clinics. Intestinal microbiota disorder is correlated with ulcerative colitis. Although there are many studies on ulcerative colitis in rats, there are few studies on colitis in cats. Therefore, this study explored the possibility of the use of BBR as a safe and efficient treatment for colitis in cats. The results demonstrated the therapeutic effects of BBR on UC based on the state of the intestinal flora. The study found BBR supplementation to be effective against dextran sulfate sodium (DSS)-induced colitis, smooth muscle damage, and gut microbiota dysbiosis.
KEYWORDS gut microbiome, ulcerative colitis, intestinal smooth muscle, host-bacterial interactions
U
lcerative colitis (UC), the most common type of inflammatory bowel disease (IBD), is a global public health concern (1). It develops via the convergence of environ-
mental, microbial immunological, and genetic factors (2). As a primary form of IBD, UC mainly involves the rectum, extends to the entire colon, and affects the colonic mucosa and submucosa (3). Maintaining the structure and producing peristaltic and segmental movements of the smooth muscle is essential for the intestine (4). Intestinal microbiota disorder is an important risk factor for UC (5, 6). In recent years, increasing evidence has indicated that intestinal flora plays a vital role in the progression of colitis (7–9).
Editor Yunhe Fu, Jilin University Ad Hoc Peer Reviewer Jianzhu Liu, Shandong Agricultural University Copyright © 2022 Li et al. This is an openaccess article distributed under the terms of the Creative Commons Attribution 4.0 International license. Address correspondence to Xue-Jiao Gao, [email protected], or Meng-yao Guo, [email protected]. The authors declare no conflict of interest.
Received 27 August 2022 Accepted 27 September 2022 Published 26 October 2022
Thus, the reshaping of the intestinal microflora is a potential target in UC treatment intervention strategies.
Antibiotics, as the primary clinical treatment for the intestinal inflammation, may lead to disorders involving the intestinal flora of the organism and may generate drug-resistant genes, making the prevention and treatment of the disease more difficult (10). Berberine (BBR), as one of the most common traditional Chinese medicines, is an alkaloid extracted from several Chinese herbs. It has been widely used as an antidiarrheal medication and an effective remedy for metabolic disorders (11) and also has substantial antioxidant, antiinflammatory, antihyperglycemic, and hypolipidemic effects (12–15). Several studies have shown that BBR has a significant effect on the bioavailability of nutrients in the intestine, which suggests that it may impact on the gut microbiome (16–18). Studies have shown that BBR attenuates dextran sulfate sodium (DSS)-induced inflammation in rats by downregulating the JAK2/STAT3 pathway (19–21). NLRP3, an essential component of innate immunity, is activated and can regulate the caspase-1 activity, contributing to the activation of cytokine precursor pro-interleukin-1b (pro-IL-1b) and pro-IL-18 in DSS-induced models (22–24). The mechanisms responsible for the link between the beneficial effects of BBR on colitis and gut microbiota are not fully understood. Although many previous studies have shown that BBR caused alterations in the intestinal flora of mice with inflammation (25–28), intestinal infections in cats are more common and receive an increasing degree of attention in clinical practice, which increases the value of studying intestinal diseases in cats. Dextran sulfate sodium (DSS) has been used widely to generate an experimental model of UC disease. The clinical phenotype of the animal model shares a high similarity with that of patients with UC (5, 29–31).
Our study investigated the effects of BBR on the interactions between the colon and the gut microbiota in DSS-induced cats. Comprehensive metagenomics analyses were employed to analyze the potential for regulating the gut microbiome with BBR. We used 16S rRNA gene sequencing to detect the alterations of microbiota and recognize differential metabolites in order to illuminate the mechanism of BBR in the treatment of DSS-induced cat models. Our results showed that BBR supplementation improves the intestinal barrier, restores gut microbiota, modifies the metabolic profile, and suppresses the JAK2/STAT3 signaling pathway. In addition, BBR ameliorates intestinal inflammation by restoring myosin light chain (MLC) phosphorylation in the intestinal smooth muscles to normal levels. Accordingly, our data suggest that BBR has significant potential to alleviate UC.
RESULTS
BBR attenuated DSS-induced colitis. Our results showed that the induction of DSS caused typical UC symptoms in cats, such as diarrhea and hematochezia (Fig. 1B), and a marked shift in disease activity index (DAI) score (Fig. 1D) and body weight (Fig.
- S1). Additionally, the colon length of the cat was significantly shortened in the DSSinduced group (Fig. 1C). Hematoxylin and eosin (HE) staining of the colon showed that DSS treatment caused severe enteric mucosal injury (Fig. 1E). However, all characteristic features were prevented by oral BBR supplementation. These results indicate that BBR can alleviate the overall symptoms of DSS-induced colitis in cats and alleviate colonic injury.
- S2). Next, we analyzed the differences in intestinal flora at the family and genus levels (Fig. 2A and B). At the family level, Prevotellaceae, Lachnospiraceae, Selenomonadaceae, Veillonellaceae, and Lactobacillacrae were significant in the control group, and in the DSS-induced group, there was an increase in the richness of Bacteroidaceae and Fusobacteriaceae. After treatment with BBR, there was an increase in beneficial bacteria, such as Lactobacillacrae and Prevotellaceae and a reduction in the richness of Bacteroidaceae. At the genus level, the DSSinduced group showed an increase in the richness of Bacteroides and Fusobacterium, and after treatment with BBR, there was an increase in beneficial bacteria, such as Lactobacillus and
- FIG 1 Berberine (BBR) attenuates the symptoms of dextran sulfate sodium (DSS)-induced cat colitis. (A) Experimental design to test the effects of BBR on DSS-induced cat. (B) Diarrhea and blood conditions of DSS-induced colitis (DSS) group and berberine treatment (DSS1BBR) group. (C) Effect of DSS and BBR on colonic length. (D) Disease activity index of cat during colitis. (E) Representative images of hematoxylin and eosin (HE)-stained colon tissue samples. The data are expressed as means 6 standard error of the mean (SEM) (n = 4). *, P , 0.05; **, P , 0.01.
Prevotella and a reduction in the richness of Bacteroides. The results showed that the intestinal flora of DSS-induced colitis is changed by BBR treatment.
Effects of BBR on intestinal flora diversity of cats. b-Diversity analysis is mainly used to analyze differences between the groups. Using a principal-component analysis (PCA) and a principal coordinates analysis (PCoA), differences in species composition abundance were compared by analyzing the projected distances on the axes among the samples. PCA (Fig. 3A) and PCoA analyses (Fig. 3B) were used to evaluate the similarities and differences between the three groups. PCA indicated that intestinal flora diversity was higher in the DSS-induced group than in the control group and was reduced after treatment with BBR. PCoA indicated that the gut microbiota composition of the BBR group was different from the DSS group in terms of axis PCo-1. These results suggest that the administration of BBR maintains the intestinal flora diversity.
BBR effected species differences and metabolic pathway function. In this study, we performed 16S rRNA gene high-throughput sequencing to reveal the impact of BBR on the gut microbiota. The Venn diagram is used as a community analysis to investigate which species are common and unique among different groups. It can be seen that the difference in operational taxonomic unit (OTU) between the DSS1BBR group and the DSS group at the phylum level is not apparent, mainly with Firmicutes, Bacteroidetes, and Proteobacteria; at the genus level, Prevotella shows the most evident change, followed by Bacteroides and Clostridium. There is a difference in relative abundance between the DSS1BBR group and the DSS group in the Firmicutes, Fusobacteria, and Proteobacteria. At the genus level, significant differences can be seen in Prevotella, Bacteroides, Blautia, Cellulosilyticum, and Fusobacterium in both the DSS1BBR and DSS groups (Fig. 4A and B).
- FIG 2 Comparative structural and species analysis of gut microbiota in BBR cats. (A, B) Taxonomic analysis of microbiota in fecal samples at the top 20 family levels (A) and genus levels (B) between control group (CON), DSS-induced colitis (DSS) group, and berberine treatment (DSS1BBR) group.
Heat maps were used to analyze species composition so as to display the trend of species abundance distribution among samples and further compare species composition differences (Fig. 5A). The Collonsella aerofaciens, Bifidobacterium adoiescentis, Megasphaera eisdenii, Bacteroides plebeius, and Lactobacillus ruminis were significant in the control group. The DSS-induced group showed an increase in Bacteroides fragilis and a reduction in Lactobacillus ruminis. After the treatment with BBR, there was an increase in the beneficial bacteria, such as Lactobacillus ruminis. A random forest analysis was used to classify the microbial community samples (Fig. 5B). The DSS-induced group showed an increase in harmful bacteria, such as Bacteroides fragilis, and a reduction in the beneficial bacteria, such as Lactobacillus ruminis. However, the balance between harmful and beneficial bacteria was restored after treatment with BBR.
The analysis of fecal flora metabolic pathways in cats allowed for predicting the relevant functions of their flora and analyzing the effect of BBR on the role of feline intestinal flora. The abundance of secondary functional pathways for all samples is shown in Fig. 6A, which shows that the highest possible of metabolism-related tracks was observed and that human disease and genetic information processing were followed. Fig. 6B shows multiple MetaCyc secondary functional pathways for all samples, which demonstrates the highest quantity of ways related to biosynthesis and degradation/ utilization/assimilation. These results indicate that metabolic pathway function and species differences are improved after treatment with BBR.
BBR improved the symptoms of DSS-induced UC in cats through the JAK2/ STAT3 signaling pathways. Next, we assessed the effects of BBR administration on DSS-induced proinflammatory responses. The DSS-induced group had significantly increased serum IL-1b, IL-6, and tumor necrosis factor-a(TNF-a) levels compared with the control group. Conversely, BBR supplementation remarkably reversed this tendency (Fig. 7A). Exploring the underlying mechanism by which BBR modulates DSS-induced colitis, we found that the DSS-induced group showed significant increase in mRNA level expression of inflammatory factors. The results showed that the JAK2/STAT3 signaling pathways were associated with inflammation, such as IL-6, TNF-a, IL-1b, IL-18, NLRP3, Caspase-1, JAK2, and STAT3 (Fig. 7B). As seen in Fig. 7C, the protein expressions of JAK2, STAT3, and other related proteins in the pathway were increased in the DSS group
- FIG 3 Effects of BBR on intestinal flora diversity of cats. b-Diversity was assessed using. (A) PCA, (B) PCoA. Every point in the figure represents a sample, and points of different colors indicate different groups. The percentages of the coordinate axes are shown the influences that cause differences in species composition between groups.
compared to the control group. The protein expressions in the BBR group were decreased compared to those in the DSS group. Still, their expressions were higher than in the control group. The above results demonstrate that BBR can reduce inflammation through the JAK2/STAT3 signaling pathway.
BBR leads to contraction of colonic smooth muscle. Our study showed that the Ca21 concentration (Fig. 8A) was changed with the intestinal smooth muscle damage. DSS-induced models showed increases in Ca21 concentration, while the results were the opposite in the BBR group. Intestinal motility is positively associated with MLC phosphorylation in the smooth muscle. The relative activities of MLCK regulate smooth muscle MLC phosphorylation. The present study results indicated a significant increase in MLC phosphorylation in the colonic smooth muscle of the DSS-induced cats (Fig. 8B and C). However, these effects were significantly reversed after the BBR administration. The increased MLCK mRNA expression levels also changed considerably (Fig. 8D). It is thus concluded that BBR has a substantial impact on colonic smooth muscle contraction.
DISCUSSION
IBD is a common chronic disease receiving global public health research attention (32). UC is an atopic form of IBD with frequent morbidity. The development of colitis is accompanied by changes in the contraction of the smooth muscle of the colon. In recent years, many studies have focused on the relationship between UC and related diseases and intestinal flora (33–35). The functions of the intestinal flora include aiding in the digestion of food, breakdown and absorption of nutrients, secretion of appropriate amounts of antimicrobial peptides to defend against colonization by harmful bacteria, and maintenance of the intestinal mucosal barrier. The impact of the intestinal flora on the immune system are
- also important (36, 37). Our studies used DSS to induce UC in model cats because it can successfully induce high rates of stable colitis-associated characteristics. As expected, the cats with DSS-induced colitis showed various disease features comparable to those observed in patients with UC. The use of antibiotics and immune-suppressive drugs for colitis has become common, but most of these treatments have side effects (38,
- FIG 4 Community analysis of DSS-induced colitis (DSS) group and berberine treatment (DSS+BBR) group. (A) Statistical histogram of proportion of relative abundance in phylum and genus of the Wayne chart. (B) Venn diagram of sample group amplicon sequence variants (ASV)/operational taxonomic unit (OTU) between three groups.
FIG 5 BBR causes species difference analysis and marker species. (A) Genus level species composition heat map of species. (B)Random forest analysis of the dominant biomarker taxa between three groups.
FIG 6 BBR causes altered metabolic pathway function. (A, B) Predicted KEGG (A) and MetaCyc (B) secondary functionalpathway analysis of DSS-induced colitis (DSS) group and berberine treatment (DSS+BBR) group.
- FIG 7 Effects of BBR on inflammatory-associated factors in DSS-induced cats. (A) Interleukin-1b (IL-1b), IL-6, and tumor necrosis factor-a (TNF-a) were detected using enzyme-linked immunosorbent assay (ELISA) kits. (B) Relative mRNA expression of inflammatory factors in the colon evaluated by quantitative reverse transcription PCR (qRT-PCR). (C) JAK2, STAT3, and other related proteins in the pathway protein expression. The data are expressed as the means 6 SEM (n = 4) and analyzed using one-way analysis of variance (ANOVA) with Tukey post hoc analysis. DSS-induced colitis (DSS) group/ berberine treatment (DSS1BBR) group (versue control group [CON]). *, P , 0.05; **, P , 0.01; ***, P , 0.001; ****, P , 0.0001.
39). As an alternative, traditional plant therapy has received increasing attention. BBR, as an over-the-counter medicine, is readily available and inexpensive. Many studies have investigated the mechanism of action of herbal medicine in the treatment of colitis (40–42). Our study found BBR supplementation to be effective against DSS-induced colitis, smooth muscle damage, and gut microbiota dysbiosis.
Pathogenic intestinal microbiota plays a critical role in chronic inflammation. The
- alteration of the gut environment can lead to microbiota dysbiosis. Intestinal microbial composition and diversity are decreased in mice with colitis (43–45). DSS changed the colon microbial community composition and diversity. The development of ulcerative colitis leads to a disturbance in the gut microbiota; resident bacteria are excreted in large numbers through the feces during diarrhea. For instance, with the highest relative abundance of microbiota, Bacteroidetes was increased and Firmicutes was decreased by DSS. The increase of Bacteroidetes and the ratio of Bacteroidetes/Firmicutes are the indicators of IBD (17, 46, 47). Our results showed that BBR can decrease Bacteroidetes and increase Firmicutes
- FIG 8 Alterations of distal colon smooth muscle contraction. (A) Effect of BBR on Ca2 content in colon smooth muscle contraction. (B) Relative mRNA expression of smooth muscle factors in the colon evaluated by qRT-PCR. (C, D) The protein expression of myosin light chain (MLC), MLC phosphorylation (p-MLC), p-MLC/MLC, MLCK myosin light chain kinase (MLCK), and calmodulin (CaM) in BBR-treated DSS cat models. The data are expressed as the means 6 SEM (n = 4) and analyzed using oneway ANOVA with Tukey post hoc analysis. DSS-induced colitis (DSS) group/berberine treatment (DSS1BBR) group (versue control group [CON]). *, P , 0.05; **, P , 0.01; ***, P , 0.001; ****, P , 0.0001. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
in DSS-induced cats. BBR reshaped the microbiota composition by reducing the abundance of Proteobacteria. In the genus of bacteria, BBR can regulate the biodiversity and structure of the intestinal flora of cats. The richness and homogeneity of species is increased with the increase of beneficial bacteria and the decrease of harmful bacteria in the organism, such as Prevotellaceae. In the treatment of DSS-induced colitis with BBR, restoration of the mucosal barrier and the extent of the inflammatory response is improved by regulation of the intestinal flora.
At the biomolecular level, BBR causes a reduction of inflammatory damage in the animal organism by activating inflammatory vesicle NLRP3, which binds to ASC. Further, the expression of inflammatory factors is decreased, such as IL-6, IL-18, IL-10, TNF-a, and IL-1b (14, 48). IL-6 activates the downstream JAK2. The overexpression of IL-10 in UC mice may be due to an imbalance between proinflammatory and antiinflammatory cytokines due to insufficient secretion of antiinflammatory factors, and BBR causes changes in inflammatory factors through the JAK2/STAT3 signaling pathway (49). Consistent with previous investigations, our results showed that BBR can inhibit inflammatory-associated mediators’ expression by dampening the JAK2/STAT3 signaling activation in cats with DSS-induced colitis. The present study results demonstrate that BBR improves the symptoms and inflammation in DSS-induced cats, which lays the foundation for further investigation of the effects of BBR on smooth muscle motility-related phosphorylation (50). The phosphorylation of MLC regulates smooth muscle contractility. Motility disorders related to abnormal regulation of the Ca21 are observed in gastrointestinal inflammatory disorders (51, 52). As in previous studies, our results showed that the increasing MLC phosphorylation in the DSS-induced cats was returned to normal levels by treatment with BBR, indicating that BBR benefits inflammation-related intestinal motility. BBR can restore intestinal smooth muscle function.
Conclusion. Our study investigated the therapeutic effects of BBR on UC based on intestinal flora and tissue distribution analysis. BBR plays a vital role in modulating intestinal flora and intestinal smoothing mechanisms by improving UC symptoms because of its antiinflammatory effects in pathological conditions. Notably, BBR tends to have unique effects that remain consistent when used in clinical practice. BBR has a long tradition as a botanical medicine for treating gastrointestinal disorders, and these data are expected to provide necessary information for the targeted application of BBR in UC treatment.
MATERIALS AND METHODS
Experimental protocol and animals. Nine healthy adult shorthair cats (weight, 2.0 to 2.3 kg) were randomly allocated into three groups: control group (CON), DSS-induced colitis (DSS) group, and berberine treatment (DSS1BBR) group. All experimental studies were conducted in accordance with the humanitarian spirit and in accordance with the standards of the Institutional Animal Care and Use Committee of Northeast Agricultural University (grant number NEAUEC20220340). The cats in the DSS group and DSS1BBR group were given 5% DSS in water for 10 days. Between days 10 and 17, the DSS1BBR group was administered BBR (80 mg/kg/day), and the weight of each animal was recorded. On the day 18 of the experiment, the cats were anesthetized by intraperitoneal injection with pentobarbital sodium (35 mg/kg) before samples of tissues and blood were collected. Colon samples were harvested and stored at 80°C for further experiments. The animals were housed under standard conditions and received humane care complying with institutional guidelines. The experimental design used to test the effects of BBR on DSS-induced cats is shown in Fig. 1A.
Disease activity index (DAI) measures. DAI is a comprehensive score that has been used to evaluate the severity of DSS-induced colitis in animal models, including general health condition, weight loss, stool consistency, and degree of fecal bleeding (30). The scoring is as follows: score 0 indicates no weight loss, average stool properties, negative occult blood test; score 1 indicates a weight loss of 1 to 5%, soft stool, and negative occult blood test; score 2 indicates a weight loss of 5 to 10%, pale stool, and positive occult blood test; score 3 indicates a weight loss of 10 to 15%, diarrhea, and positive occult blood positive test; and 4 points indicates a weight loss of .15%, diarrhea, and bloody stools. From days 10 to 17, the general health condition, weight loss, stool consistency, and degree of fecal bleeding of the three groups was recorded.
16S rRNA gene sequencing study and bioinformatics analysis. Fecal samples were collected from the three groups, and the fecal microbiomes were examined using 16S rRNA gene sequencing carried out by the Shanghai Personalbio Biotechnology Corp. The total genomic DNA was extracted according to the manufacturer’s protocol. The DNA concentration and purity were tested using Nanodrop and 1% agarose gel
- TABLE 1 Primers used for quantitative PCRa
Species Gene Primer (59 to 39) Cat TNF-a Forward CACATGGCCTGCAACTAATCA
Reverse CAGCTTCGGGGTTTGCTAC IL-6 Forward GACTCCAGCCATGACCTTCC
Reverse GGGTAGGGAAAGCAGTAGCC IL-10 Forward AAACAGCACGTGAACTCCCT
Reverse AGAAATCGATGACAGGCGCC IL-1b Forward AACCAACAAGTGGTGTTCCG
Reverse GTAGGGTGGGTTTCCCGTCT IL-18 Forward TGACTGTACAGATAATGCACCCC Reverse GCCAGACCTCTAGTGAGGCTA NLRP3 Forward GAGGAGGAAGAGGAGGAGGAAGTG
Reverse AAGGCTAACAGTGAGATGGCAGTTC Caspase-1 Forward TCAGGAGGAGGGCTGGTCTA
Reverse TGTTTCACCACCTCGTATCCC JAK2 Forward CGAGACCCGACACAGTTTGAAGAG
Reverse CACATCTCCACACTGCCAAAATTGC STAT3 Forward GAGAAGGACATCAGCGGCAAGAC
Reverse GAGATAAACCAGCGGAGACACGAG b-Actin Forward CCTGGCACCTAGCACAATGA
Reverse CCTGCTTGCTGATCCACATC
aIL, interleukin; TNF-a, tumor necrosis factor-a.
electrophoresis. Pfu high fidelity DNA polymerase was used for PCR amplification, and the number of amplification cycles was strictly controlled. The amplified products were purified and recovered by magnetic beads. The recovered effects were amplified by PCR and quantified by fluorescent light. The fluorescent reagent was Quant-iT PicoGreen dsDNA assay kit, and MiSeq was used to perform high-throughput sequencing. Analysis was performed using QIIME2 software. The a-diversity in each sample was assessed based on the distribution of the amplicon sequence variants (ASV)/OTU in the different models. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was conducted using tools available in the KEGG database. The OTUs reached a 97% nucleotide similarity level.
Quantitative reverse transcription PCR. Total RNA was extracted from colon tissue and reversing transcription were performed. The cDNA was synthesized using standard procedures. The primers used to amplify related genes are designed by the software Primer 5.0. The mRNA expression of colonic TNFa, IL-6, IL-10, IL-1b, IL-18, NLRP3, Caspase-1, JAK2, STAT3, MLC, MLCK, and calmodulin (CaM) was quantified by applying Light Cycler technology and SYBR green PCR core reagent kits. The relative changes in the gene expression were analyzed according to the 22DDCT method. Primers used for quantitative PCR (qPCR) in Table 1.
ELISA. Cat colon tissues were homogenized in ice-cold phosphate-buffered saline (PBS) and centrifuged at 13,000 g at 4°C for 20 min. The supernatant was collected to analyze the concentrations of secretory immunoglobulin. IL-6, IL-1b, and TNF-a in the serum were measured with the corresponding enzyme-linked immunosorbent assay (ELISA) kits (Nanjing Jiancheng Bio, Inc., China) and measured using a microplate reader (Bio-Rad, Hercules, CA, USA) at 450 nm. All steps were completed according to the manufacturer’s instructions.
Cytosolic Ca2+ measurements. Tissue homogenization was done as described above (53). Calcium ions in the sample were combined with Methyl Thyme Aroma Blue (MTA) in an alkaline solution to form a blue complex. We measured the calcium content of the samples according to the calcium standard curve. The expression of Ca21 in the colon tissues was measured with the corresponding kits (Nanjing Jiancheng Bio, Inc., China, C004-2-1). All steps were completed according to the manufacturer’s instructions.
Western blotting. The colon tissue (0.1 g) was ground with liquid nitrogen for Western blot analysis. The protein samples were subjected to SDS-polyacrylamide gel electrophoresis with a concentration of 12%,10%, and 8% separation gels. Then, the proteins were transferred to a polyvinylidene fluoride membrane at 250 mA in a Tris-glycine buffer. Subsequently, the membranes were blocked with 5% fat-dry milk at 37°C for 2 h in the shaker, incubated overnight with diluted primary antibodies against the cat, including NLRP3, ASC, Caspase-1, JAK2, STAT3, smooth muscle contraction-associated speck-like protein containing MLC, p-MLC, CaM, and MLCK at 4°C. The membrane was incubated with secondary antibodies for 2 h (horseradish peroxidase-conjugated goat antirabbit IgG, 1:1,000, CST, 7074). The protein bands were detected and quantified using gel imaging system software (TransGen Biotech Co., Beijing, China). b-Actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as internal references. Antibodies information for Western Blot in Table 2.
Statistical analysis. Statistical analyses were performed using GraphPad Prism 8.0.1 software (New York, NY, USA). The data are expressed as means 6 standard error of the mean (SEM). One-way analysis of variance (ANOVA) followed by Tukey post hoc analysis was applied when evaluating differences between three groups. P values , 0.05 were considered statistically significant.
- TABLE 2 Antibodies required for Western blota
Name Catalog no. Company Dilution times b-Actin AC026 ABclonal Technology 1:1,000 GAPDH D16H11 Cell Signaling Technology 1:1,000 NLRP3 13158 Cell Signaling Technology 1:1,000 ASC 67824 Cell Signaling Technology 1:1,000 Caspase-1 24232 Cell Signaling Technology 1:1,000 JAK2 3230 Cell Signaling Technology 1:1,000 STAT3 9139 Cell Signaling Technology 1:1,000 CaM 60335to-lg Proteintech 1:500 Rock 21850-1-AP Proteintech 1:1,000 RhoA 10749-1-AP Proteintech 1:1,000 MLCK 21173-1-AP Proteintech 1:500 MLC 10906-1-AP Proteintech 1:500 p-MLC AF8618 Affinity 1:500
aCaM, calmodulin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MLC, myosin light chain; p-MLC, MLC phosphorylation; MLCK, Myosin light chain kinase.
Data availability. The data sets supporting the conclusions of this article are available in the NCBI SRA (https://www.ncbi.nlm.nih.gov/sra) under BioProject accession number PRJNA873140.
SUPPLEMENTAL MATERIAL Supplemental material is available online only. SUPPLEMENTAL FILE 1, PDF file, 0.2 MB.
REFERENCES
- 1. Shen Q, Huang Z, Yao J, Jin Y. 2022. Extracellular vesicles-mediated interaction within intestinal microenvironment in inflammatory bowel disease. J Adv Res 37:221–233. https://doi.org/10.1016/j.jare.2021.07.002
- 2. Ranjan M, Kante B, Vuyyuru S, Kumar P, Mundhra S, Golla R, Sharma R, Sahni P, Das P, Makharia G, Kedia S, Ahuja V. 2022. Minimal risk of lymphoma and nonmelanoma skin cancer despite long-term use of thiopurines in patients with inflammatory bowel disease: alongitudinal cohort analysis from Northern India. J Gastroenterol Hepatol 37:1544–1553. https://doi.org/10.1111/jgh.15880.
- 3. Bahceci D, Lauwers G, Choi W. 2022. Clinicopathologic features of undetected dysplasia found in total colectomy or proctocolectomy specimens of patients with inflammatory bowel disease. Histopathology 81:183–191. https://doi.org/10.1111/his.14673.
- 4. Al-Qudah M, Shammala D, Al-Dwairi A, Al-Shboul O, Mustafa A. 2017. Dextran sodium sulphate (DSS)-induced colitis alters the expression of neurotrophins in smooth muscle cells of rat colon. Physiol Res 66:1009–1020. https://doi.org/10.33549/physiolres.933465.
- 5. Gu W, Zhang L, Han T, Huang H, Chen J. 2022. Dynamic changes in gut microbiome of ulcerative colitis: initial study from animal model. J Inflamm Res 15:2631–2647. https://doi.org/10.2147/JIR.S358807.
- 6. Li X, Lv H, Shi F, Song J, Zhang Z. 2022. The potential therapeutic effects of hydroxypropyl cellulose on acute murine colitis induced by DSS. Carbohydr Polym 289:119430. https://doi.org/10.1016/j.carbpol.2022.119430.
- 7. Ma L, Zhao X, Liu T, Wang Y, Wang J, Kong L, Zhao Q, Chen Y, Chen L, Zhang H. 2022. Xuanfei Baidu decoction attenuates intestinal disorders by modulating NF-kB pathway, regulating T cell immunity and improving intestinal flora. Phytomed Int J Phytother Phytopharmacol 101:154100. https://doi.org/10.1016/j.phymed.2022.154100
- 8. Pan D, Huang B, Gan Y, Gao C, Liu Y, Tang Z. 2022. Phycocyanin ameliorates colitis-associated colorectal cancer by regulating the gut microbiota and the IL-17 signaling pathway. Marine Drugs 20:260. https://doi.org/10
- 9. Deng L, Wojciech L, Png CW, Koh EY, Aung TT, Kioh DYQ, Chan ECY, Malleret B, Zhang Y, Peng G, Gascoigne NRJ, Tan KSW. 2022. Experimental colonization with blastocystis ST4 is associated with protective immune responses and modulation of gut microbiome in a DSS-induced colitis mouse model. Cell Mol Life Sci 79:245. https://doi.org/10.1007/s00018-022-04271-9.
- 10. Becattini S, Taur Y, Pamer EG. 2016. Antibiotic-induced changes in the intestinal microbiota and disease. Trends Mol Med 22:458–478. https://doi
.org/10.1016/j.molmed.2016.04.003.
- 11. Dong Y, Fan H, Zhang Z, Jiang F, Li M, Zhou H, Guo W, Zhang Z, Kang Z, Gui Y, Shou Z, Li J, Zhu R, Fu Y, Sarapultsev A, Wang H, Luo S, Zhang G, Hu D. 2022. Berberine ameliorates DSS-induced intestinal mucosal barrier dysfunction through microbiota-dependence and Wnt/b-catenin pathway. Int J Biol Sci 18:1381–1397. https://doi.org/10.7150/ijbs.65476.
- 12. Xu YQ, Li A, Li X, Deng X, Gao XJ. 2022. Zinc deficiency induces inflammation and apoptosis via oxidative stress in the kidneys of mice. Biol Trace Elem Res. https://doi.org/10.1007/s12011-022-03166-x.
- 13. Wu C, Zhao Y, Zhang Y, Yang Y, Su W, Yang Y, Sun L, Zhang F, Yu J, Wang Y, Guo P, Zhu B, Wu S. 2022. Gut microbiota specifically mediates the antihypercholesterolemic effect of berberine (BBR) and facilitates to predict BBR’s cholesterol-decreasing efficacy in patients. J Adv Res 37:197–208. https://doi.org/10.1016/j.jare.2021.07.011.
- 14. Chen J, Huang Y, Bian X, He Y. 2022. Berberine ameliorates inflammation in acute lung injury via NF-kB/Nlrp3 signaling pathway. Front Nutr 9:
- 15. Yardim A, Gur C, Comakli S, Ozdemir S, Kucukler S, Celik H, Kandemir FM.
- 16. Zhao X, Cui D, Yuan W, Chen C, Liu Q. 2022. Berberine represses Wnt/b-catenin pathway activation via modulating the microRNA-103a-3p/Bromodomain-containing protein 4 axis, thereby refraining pyroptosis and reducing the intestinal mucosal barrier defect induced via colitis. Bioengineered 13: 7392 7409. https://doi.org/10.1080/21655979.2022.2047405.
- 17. Deng J, Zhao L, Yuan X, Li Y, Shi J, Zhang H, Zhao Y, Han L, Wang H, Yan Y, Zhao H, Wang H, Zou F. 2022. Pre-administration of berberine exerts chemopreventive effects in AOM/DSS-induced colitis-associated carcinogenesis mice via modulating inflammation and intestinal microbiota. Nutrients 14:726. https://doi.org/10.3390/nu14040726.
- 18. Cao JW, Chen MY, Xu R, Guo MY. 2022. Therapeutic mechanisms of berberine to improve the intestinal barrier function via modulating gut microbiota, TLR4/NF-kappa B/MTORC pathway and autophagy in cats. Front Microbiol 13:961885. https://doi.org/10.3389/fmicb.2022.961885.
- 19. Zhao Y, Li Z, Lu E, Sheng Q, Zhao Y. 2021. Berberine exerts neuroprotective activities against cerebral ischemia/reperfusion injury through upregulating PPAR-gto suppress NF-kB-mediated pyroptosis. Brain Res Bull 177:22–30. https://doi.org/10.1016/j.brainresbull.2021.09.005.
- 20. Xu M, Ren L, Fan J, Huang L, Zhou L, Li X, Ye X. 2022. Berberine inhibits gastric cancer development and progression by regulating the JAK2/ STAT3 pathway and downregulating IL-6. Life Sci 290:120266. https://doi
- 21. Lin G, Yu Q, Xu L, Huang Z, Mai L, Jiang L, Su Z, Xie J, Li Y, Liu Y, Lin Z, Chen J.
- 22. Zhang QR, Xue Y, Fu YX, Bao BW, Guo MY. 2022. Zinc deficiency aggravates oxidative stress leading to inflammation and fibrosis in lung of mice. Biol Trace Elem Res 200:4045 4057. https://doi.org/10.1007/s12011-021-03011-7.
- 23. Shen F, Xie P, Li C, Bian Z, Wang X, Peng D, Zhu G. 2022. Polysaccharides from Polygonatum cyrtonema Hua reduce depression-like behavior in mice by inhibiting oxidative stress-Calpain-1-NLRP3 signaling axis. Oxid Med Cell Longev 2022:2566917. https://doi.org/10.1155/2022/2566917.
- 24. Xue Y, Wang HH, Tian BW, Wang SB, Gao XJ. 2022. Selenium deficiency promotes the expression of LncRNA-MORC3, activating NLRP3-Caspase-1/IL-1 beta Signaling to induce inflammatory damage and disrupt tight junctions in piglets. Biol Trace Elem Res. https://doi.org/10.1007/s12011-022-03341-0.
- 25. Seth E, Chopra M. 2022. Neuroprotective efficacy of berberine following developmental exposure to chlorpyrifos in F1 generation of Wistar rats: apoptosis-autophagy interplay. Sci Total Environ 834:155292. https://doi
- 26. Shimizu S, Nagao Y, Kurabayashi A, Shimizu T, Higashi Y, Karashima T, Saito M. 2022. Effects of losartan on bladder dysfunction due to agingrelated severe hypertension in rats. Eur J Pharmacol 922:174911. https:// doi.org/10.1016/j.ejphar.2022.174911.
- 27. Luo H, Chen X, Zhuang P, Wu S, Wei J, Xu W. 2022. Cotransplantation with RADA16-PRG-self-assembled nanopeptide scaffolds, bone mesenchymal stem cells and brain-derived neurotrophic factor-adeno-associated virus promote functional repair after acute spinal cord injury in rats. J Biomed Nanotechnol 18:225–233. https://doi.org/10.1166/jbn.2022.3216.
- 28. Jing W, Dong S, Luo X, Liu J, Wei B, Du W, Yang L, Luo H, Wang Y, Wang S, Lu H. 2021. Berberine improves colitis by triggering AhR activation by microbial tryptophan catabolites. Pharmacol Res 164:105358. https://doi
- 29. Jia X, Gao Y, Liu L, Guo Y, Wang J, Ma H, Zhao R, Li B, Du Y, Yang Q. 2022. Artemisinin alleviates intestinal inflammation and metabolic disturbance in ulcerative colitis rats induced by DSS. Evid Based Complement Alternat Med 2022:6211215. https://doi.org/10.1155/2022/6211215.
- 30. Kim HJ, Eom JY, Choi SH, Seo HJ, Kwun IS, Chun IJ, Sung J, Lim JH, Kim J, Song BJ, Lee CH, Kim DK, Baek MC, Cho YE. 2022. Plum prevents intestinal and hepatic inflammation in the acute and chronic models of dextran sulfate sodium-induced mouse colitis. Mol Nutr Food Res 66:e2101049. https://doi
- 31. Huang LJ, Wang YM, Gong LQ, Hu C, Gui Y, Zhang C, Tan X, Yu XK, Liao YL, Luo Y, Tang YQ, Dai YF, Deng Y, Wang D, Guo DL. 2022. N-Acetyldopamine dimer attenuates DSS-inducedulcerativecolitis bysuppressing NF-kBandMAPKpathways. Front Pharmacol 13:842730. https://doi.org/10.3389/fphar.2022.842730.
- 32. Kuenzig ME, Fung SG, Marderfeld L, Mak JW, Kaplan GG, Ng SC, Wilson DC, Cameron F, Henderson P, Kotze PG, Bhatti J, Fang V, Gerber S, Guay E, Kotteduwa Jayawarden S, Kadota L, Maldonado D F, Osei JA, Sandarage R, Stanton A, Wan M, Benchimol EI, Bhatti J, Gerber S, Guay E, Jayawarden SK, Kadota L, Maldonado F, Maltus E, Bhattacharya S, Osei J, Sandarage R, Stanton A, Wan M. 2022. Twenty-first century trends in the global epidemiology of pediatric-onset inflammatory bowel disease: systematic review. Gastroenterology 162:1147 1159.e4. https://doi.org/10.1053/j.gastro.2021.12.282.
- 33. Zuo W, Wang B, Bai X, Luan Y, Fan Y, Michail S, Sun F. 2022. 16S rRNA and metagenomic shotgun sequencing data revealed consistent patterns of gut microbiome signature in pediatric ulcerative colitis. Sci Rep 12:6421. https://doi.org/10.1038/s41598-022-07995-7.
- 34. Mirsepasi-Lauridsen HC, Vranckx K, Nielsen HV, Andersen LO, Archampong T, Krogfelt KA, Petersen AM. 2022. Substantial intestinal microbiota differences between patients with ulcerative colitis from Ghana and Denmark. Front Cell Infect Microbiol 12:832500. https://doi.org/10.3389/fcimb.2022.832500.
- 35. Smith BJ, Piceno Y, Zydek M, Zhang B, Syriani LA, Terdiman JP, Kassam Z, Ma A, Lynch SV, Pollard KS, El-Nachef N. 2022. Strain-resolved analysis in a randomized trial of antibiotic pretreatment and maintenance dose delivery mode with fecal microbiota transplant for ulcerative colitis. Sci Rep
12:5517. https://doi.org/10.1038/s41598-022-09307-5.
- 36. Cook TM, Mansuy-Aubert V. 2022. Communication between the gut microbiota and peripheral nervous system in health and chronic disease. Gut Microbes 14:2068365. https://doi.org/10.1080/19490976.2022.2068365.
- 37. Xiao X, Mao X, Chen D, Yu B, He J, Yan H, Wang J. 2022. miRNAs can affect intestinal epithelial barrier in inflammatory bowel disease. Front Immunol 13:868229. https://doi.org/10.3389/fimmu.2022.868229.
- 38. Baráth B, Jász DK, Horváth T, Baráth B, Maróti G, Strifler G, Varga G, Sándor L, Perényi D, Tallósy S, Donka T, Jávor P, Boros M, Hartmann P. 2022. Mitochondrial side effects of surgical prophylactic antibiotics ceftriaxone and rifaximin lead to bowel mucosal damage. Int J Mol Sci 23:5064. https:// doi.org/10.3390/ijms23095064.
- 39. Wang N, Zhu Y, Li D, Basang W, Huang Y, Liu K, Luo Y, Chen L, Li C, Zhou X.
- 40. Zhang X, Zhang L, Chan JCP, Wang X, Zhao C, Xu Y, Xiong W, Chung WC, Liang F, Wang X, Miao J, Bian Z. 2022. Chinese herbal medicines in the treatment of ulcerative colitis: a review. Chin Med 17:43. https://doi.org/ 10.1186/s13020-022-00591-x.
- 41. Yang J, Tang C, Jin R, Liu B, Wang P, Chen Y, Zeng C. 2022. Molecular mechanisms of Huanglian jiedu decoction on ulcerative colitis based on network pharmacology and molecular docking. Sci Rep 12:5526. https:// doi.org/10.1038/s41598-022-09559-1.
- 42. Li MX, Li MY, Lei JX, Wu YZ, Li ZH, Chen LM, Zhou CL, Su JY, Huang GX, Huang XQ, Zheng XB. 2022. Huangqin decoction ameliorates DSSinduced ulcerative colitis: role of gut microbiota and amino acid metabolism, mTOR pathway and intestinal epithelial barrier. Phytomedicine 100:
- 43. Li G, Wu X, Gao X, Lin R, Chen L, Sun M, Jia J, Liu Z, Fang L, Wu W. 2022. Long-term exclusiveenteralnutritionremodelsthegutmicrobiotaandalleviatesTNBS-induced colitisinmice.FoodFunct13:1725–1740.https://doi.org/10.1039/d1fo03579g.
- 44. Liu Z, Liao W, Zhang Z, Sun R, Luo Y, Chen Q, Li X, Lu R, Ying Y. 2021. Metformin affects gut microbiota composition and diversity associated with amelioration of dextran sulfate sodium-induced colitis in mice. Front Pharmacol 12:640347. https://doi.org/10.3389/fphar.2021.640347.
- 45. Zhu HC, Jia XK, Fan Y, Xu SH, Li XY, Huang MQ, Lan ML, Xu W, Wu SS. 2021. Alisol B 23-acetate ameliorates azoxymethane/dextran sodium sulfateinduced male murine colitis-associated colorectal cancer via modulating the composition of gut microbiota and improving intestinal barrier. Front Cell Infect Microbiol 11:640225. https://doi.org/10.3389/fcimb.2021.640225.
- 46. Yao M, Fei Y, Zhang S, Qiu B, Zhu L, Li F, Berglund B, Xiao H, Li L. 2022. Gut microbiota composition in relation to the metabolism of oral administrated resveratrol. Nutrients 14:1013. https://doi.org/10.3390/nu14051013.
- 47. Noh JY, Wu CS, DeLuca JAA, Devaraj S, Jayaraman A, Alaniz RC, Tan XD, Allred CD, Sun Y. 2022. Novel role of ghrelin receptor in gut dysbiosis and experimental colitis in aging. Int J Mol Sci 23:2219. https://doi.org/10.3390/ijms23042219.
- 48. Li X, Zhang H, Qiao S, Ma W, Cai J, Zhang X, Zhang Z. 2022. Melatonin administration alleviates 2,2,4,4-tetra-brominated diphenyl ether (PBDE47)-induced necroptosis and secretion of inflammatory factors via miR140-5p/TLR4/NF-kB axis in fish kidney cells. Fish Shellfish Immunol. 128: 228–237. https://doi.org/10.1016/j.fsi.2022.08.004
- 49. Zhao GL, Yu LM, Gao WL, Duan WX, Jiang B, Liu XD, Zhang B, Liu ZH, Zhai ME, Jin ZX, Yu SQ, Wang Y. 2016. Berberine protects rat heart from ischemia/reperfusion injury via activating JAK2/STAT3 signaling and attenuating endoplasmic reticulum stress. Acta Pharmacol Sin 37:354–367. https://doi.org/10.1038/aps.2015.136.
- 50. Xing L, Zhou X, Li AH, Li HJ, He CX, Qin W, Zhao D, Li PQ, Zhu L, Cao HL.
- 51. Li H, Henty-Ridilla JL, Bernstein AM, Ganapathy PS, Herberg S. 2022. TGFb2 regulates human trabecular meshwork cell contractility via ERK and ROCK pathways with distinct signaling crosstalk dependent on the culture substrate. Curr Eye Res 47:1165–1178. https://doi.org/10.1080/02713683.2022.2071943.
- 52. Cai J, Huang J, Yang J, Chen X, Zhang H, Zhu Y, Liu Q, Zhang Z. 2022. The protective effect of selenoprotein M on non-alcoholic fatty liver disease: the role of the AMPKa1-MFN2 pathway and Parkin mitophagy. Cell Mol Life Sci Jun 9:797354.
- 53. Jing H, Zhang Q, Li S, Gao XJ. 2020. Pb exposure triggers MAPK-dependent inflammation by activating oxidative stress and miRNA-155 expression in carp head kidney. Fish Shellfish Immunol 106:219 227. https://doi
.org/10.1016/j.fsi.2020.08.015.
Figures
Figure 1
Experimental design and group allocation for the study of berberine's effects on ulcerative colitis in cats, including dosing protocol and sample collection timeline.
diagramFigure 2
Clinical symptom scores and colon histopathology from cats with ulcerative colitis treated with berberine versus controls, showing reduced inflammation severity.
chartFigure 3
Inflammatory cytokine levels (TNF-alpha, IL-6, IL-1beta) in the colonic tissue of berberine-treated cats with ulcerative colitis, indicating anti-inflammatory effects.
chartFigure 4
Smooth muscle function assessment in the feline colon, comparing berberine-treated ulcerative colitis cats to untreated controls and healthy animals.
chartFigure 5
Gut microbiota diversity analysis (alpha and beta diversity) from feline UC subjects, showing that berberine treatment shifts the microbial community toward a healthier composition.
chartFigure 6
Bacterial genus-level abundance profiles in cats with ulcerative colitis, comparing berberine treatment effects on beneficial and pathogenic gut microorganisms.
chartFigure 7
Correlation analysis between gut microbiota changes and inflammatory markers in berberine-treated cats, supporting the role of microbiome modulation in colitis improvement.
chartFigure 8
Gut microbiota composition analysis from a feline ulcerative colitis model indicates that berberine supplementation is associated with shifts in bacterial community structure. The data suggest berberine may help restore microbial balance disrupted by colonic inflammation.
chartFigure 9
Berberine treatment in cats with experimentally induced ulcerative colitis is associated with changes in microbial metabolite profiles. These metabolomic alterations suggest a potential mechanism by which berberine modulates gut inflammation.
chartFigure 10
Analysis of colonic tissue from berberine-treated cats reveals alterations in smooth muscle markers compared to untreated ulcerative colitis controls. The findings suggest berberine may help ameliorate smooth muscle dysfunction associated with intestinal inflammation.
chartFigure 11
Correlation analysis between gut microbiota changes and inflammatory markers in feline ulcerative colitis demonstrates that berberine-induced microbial shifts are associated with reduced inflammation. The relationship between specific bacterial taxa and colonic pathology is highlighted.
chartFigure 12
Pathway analysis of differentially abundant gut microbiota in berberine-treated versus untreated cats with ulcerative colitis reveals enrichment in metabolic pathways linked to anti-inflammatory responses. The data support berberine's role in modulating gut microbiota-mediated immune regulation.
diagramFigure 13
Summary of the proposed mechanism by which berberine regulates gut microbiota to ameliorate ulcerative colitis in cats, integrating findings on inflammation, smooth muscle function, and microbial community changes observed throughout the study.
diagramUsed In Evidence Reviews
Similar Papers
Microorganisms · 2022
Probiotics, Prebiotics, and Phytogenic Substances for Optimizing Gut Health in Poultry.
Pharmacological research · 2021
Main active components of Jiawei Gegen Qinlian decoction protects against ulcerative colitis under different dietary environments in a gut microbiota-dependent manner.
Pharmacological research · 2019
Gut microbiota in phytopharmacology: A comprehensive overview of concepts, reciprocal interactions, biotransformations and mode of actions.
Pharmacological research · 2021
Berberine improves colitis by triggering AhR activation by microbial tryptophan catabolites.
Metabolites · 2023
Phytochemicals and Regulation of NF-kB in Inflammatory Bowel Diseases: An Overview of In Vitro and In Vivo Effects.
American journal of physiology. Endocrinology and metabolism · 2019